Likely effect |
non-functional region (much evidence)
Model: extratranscriptic, Score: 11.16
direct link to this output
|
|
Summary |
- Histone modifications in 3+ cell lines
- might affect genomic interactions
|
analysed issue |
analysis result |
alteration (phys. location) | chr4:89442139T>G IGV
|
alteration type | SNV |
alteration region | extratranscriptic |
known variant |
database | homozygous (G/G) | heterozygous | allele carriers |
1000G |
0 | 1 | 1 |
ExAC | - | - | - |
|
promoters | RegulationSpotter - near TSSs of Ensembl transcripts |
position | evidence | gene | transcript | 4: 89441699-89442249 |
no histone marks | HERC3 | ENST00000601319 |
|
enhancers | none found |
epigenetic marks (RegulationSpotter) | no regulatory regions annotated |
histone modifications | genomic feature | blood |
artery |
vein |
immune |
ESC |
iPSC |
endocrin |
neural |
conn.tiss. |
bone |
muscle |
skin |
brain |
eye |
lung |
heart |
breast |
GIT |
liver |
pancreas |
spleen |
kidney |
ovary |
placenta |
amnion |
cervix |
testis |
H3K36me3 | erythroblast (CB) GM12878 K562 Monocytes-CD14+ (PB) Roadmap MSC (VB) naive B cell (To) naive B cell (VB) neutrophil (CB) neutrophil (VB) neutrophil myelocyte (BM) |
| EPC (VB) HUVEC HUVEC prol (CB) |
B cells (PB) Roadmap CD14+CD16- monocyte (CB) CD14+CD16- monocyte (VB) CD38- naive B cell (CB) CD4+ ab T cell (VB) CD8+ ab T cell (CB) CM CD4+ ab T cell (VB) DND-41 EM CD8+ ab T cell (VB) Fetal Thymus M0 macrophage (CB) M0 macrophage (VB) M1 macrophage (CB) M1 macrophage (VB) M2 macrophage (CB) M2 macrophage (VB) Monocytes-CD14+ Natural Killer cells (PB) |
| iPS-20b |
| | | Osteobl |
Fetal Muscle Leg HSMM HSMMtube |
NHEK |
NH-A |
| A549 |
| HMEC |
Fetal Intestine Large |
HepG2 |
| | | | Placenta |
| | |
H3K4me1 | GM12878 |
| | DND-41 |
| | | | | | | | | | | | | | | | | | | | | | |
H3K79me2 | GM12878 K562 |
| | | | | | | | | HSMM HSMMtube |
| | | | | | | | | | | | | | | |
H4K20me1 | | | | | | | | | | | | | | | | | | | | | | | | | | HeLa-S3 |
|
show features in Ensembl
explain |
polymerase | none found |
open chromatin | none found |
TFBS (confirmed) | none found |
TFBS (by motif) | no TFBS-like motif annotated
|
genomic interactions | HiC interactions
associated gene(s) |
interacting element harbouring variant... |
blood |
vein |
immune |
ESC |
iPSC |
endocrin |
neural |
conn.tiss. |
bone |
muscle |
skin |
brain |
breast |
GIT |
liver |
pancreas |
kidney |
placenta |
cervix |
testis |
lung |
gene symbol | Ensembl ID | show transcripts | HERC3 | ENSG00000138641 | | promoter | GM12878 |
HUVEC |
CD4 Naive CD4 T |
| IPS6.9 |
| | Foreskin fibroblast IMR90 NHLF |
| HSMM |
Foreskin keratinocyte NHEK |
| HMEC |
| | | | | | | |
| ENSG00000252322 | | distant element, interacts w/ promoter | GM12878 |
HUVEC |
| | | | | | | | | | | | | | | | | | |
FAM13A | ENSG00000138640 | | distant element, interacts w/ promoter | | | | | | | | | | HSMM |
| | | | | | | | | | |
HERC3 | ENSG00000138641 | | distant element, interacts w/ promoter | GM12878 |
HUVEC |
| | IPS6.9 |
| | IMR90 |
| | NHEK |
| | | | | | | | | |
LOC100129137 | ENSG00000249755 | | distant element, interacts w/ promoter | GM12878 |
| | | | | | | | | | | | | | | | | | | |
PIGY | ENSG00000255072 | | distant element, interacts w/ promoter | GM12878 |
HUVEC |
CD4 Naive CD4 T |
| IPS6.9 |
| | Foreskin fibroblast IMR90 NHLF |
| HSMM |
Foreskin keratinocyte NHEK |
| HMEC |
| | | | | | | |
show interactions as plot
|
phyloP / phastCons | | PhyloP | PhastCons |
(flanking) | 0.092 | 0 | | -0.757 | 0 | (flanking) | -3.409 | 0 | explain score(s)
and/or inspect your position(s) in in UCSC Genome Browser |
CADD (scaled) | 7.02 (please see documentation for details) |
chromosome | 4 |
strand | 1 |
original chrDNA sequence snippet | CCAAACAAACAAACGACTACTGCAAACTGGTTTATTTTTTA |
altered chrDNA sequence snippet | CCAAACAAACAAACGACTACGGCAAACTGGTTTATTTTTTA |
speed | 0.39 s |